Ordering Recommendations

If there is a known family history of a CFTR variant, please provide this information. 

If evaluating a patient for diagnostic testing (e.g. symptomatic cystic fibrosis, pancreatitis, CAVD), please provide relevant clinical information about symptoms.

Collection Container

Collect

2 ml whole blood, lavender (EDTA) top tube

Pediatric Collection

Approval required from Molecular Pathologist for Pediatric Testing; contact the Molecular Laboratory at 215-615-3094 to arrange testing.

Specimen Preparation

Do not spin or separate.

Storage/Transport Temperature

Room Temperature

Stability (from collection to initiation)

Stable at room temperature for 7 days, and refrigerated for 30 days.

Unacceptable Conditions

Clotted, hemolyzed, heparinized, frozen, or mislabeled specimens.

Remarks

For carrier screening in adults of reproductive age, for confirmatory diagnostic testing of newborns and children, or for an initial test to aid in the diagnosis of individuals with suspected cystic fibrosis: The performance characteristics of this test were verified by the Molecular Pathology Laboratory in the Department of Pathology and Laboratory Medicine at the Hospital of the University of Pennsylvania, 3400 Spruce St., Philadelphia, PA 19104. This test has been cleared by the FDA.

For all other patients not included above: This test was developed, and its performance characteristics determined by the Molecular Pathology Laboratory in the Department of Pathology and Laboratory Medicine in the University of Pennsylvania Health System at the Hospital of the University of Pennsylvania 3400 Spruce Street, Philadelphia, PA 19104. It has not been cleared or approved by the US Food and Drug Administration (FDA) for certain indications. The FDA does not require this test to go through premarket FDA review.  This test is used for clinical purposes. It should not be regarded as investigational or for research. This laboratory is certified under the Clinical Laboratory Improvement Amendments (CLIA) as qualified to perform high complexity clinical laboratory testing.

Processing - HUP

Do not spin or separate. If necessary, order in Cerner and place a barcoded sticker on the sample. Place the sample in the Molecular Pathology bin.

Processing - PAH

Prepare specimen for courier pickup.

Reference Interval

Variant not detected

Interpretive Data

VARIANTS DETECTED BY THIS ASSAY: Colloquial nomenclature for CFTR variants:
Colloquial nomenclature for CFTR mutations is followed parenthetically by standardized nomenclature based on Embank cDNA reference sequence NM_000492.3 and protein reference sequence NP_000483.3.
M1V (c.1A>G,p.Met1Val), CFTRdele2,3 (c.54-5940_273+10250del21kb, p.Ser18ArgfsX16), Q39X (c.115C>T, p.Gln39X), E60X (c.178G>T, p.Glu60X), P67L (c.200C>T, p.Pro67Leu), R75X (c.223C>T, p.Arg75X), G85E (c.254G>A, p.Gly85Glu), 394delTT (c.262_263delTT, p.Leu88IlefsX22), 405+1G>A (c.273+1G>A), 406-1G>A (c.274-1G>A), E92X (c.274G>T, p.Glu92X), E92K (c.274G>A, p.Glu92Lys), Q98X (c.292C>T, p.Gln98X), 457TAT>G (c.325_327delTATinsG, p.Tyr109GlyfsX4), D110H (c.328G>C, p.Asp110His), R117C (c.349C>T, p.Arg117Cys), R117H (c.350G>A, p.Arg117His), Y122X (c.366T>A, p.Tyr122X), 574delA (c.442delA, p.Ile148LeufsX5), 621+1G>T (c.489+1G>T), 663delT (c.531delT, p.Ile177MetfsX12), G178R (c.532G>A, p.Gly178Arg), 711+1G>T (c.579+1G>T), 711+3A>G (c.579+3A>G), 711+5G>A (c.579+5G>A), 712-1G>T (c.580-1G>T), H199Y (c.595C>T, p.His199Tyr), P205S (c.613C>T, p.Pro205Ser), L206W (c.617T>G, p.Leu206Trp), Q220X (c.658C>T, p.Gln220X), 852del22 (c.720_741delAGGGAGAATGATGATGAAGTAC, p.Gly241GlufsX13), 1078delT (c.948delT, p.Phe316LeufsX12), G330X (c.988G>T, p.Gly330X), R334W (c.1000C>T, p.Arg334Trp), I336K (c.1007T>A, p.Ile336Lys), T338I (c.1013C>T, p.Thr338Ile), 1154insTC (c.1022_1023insTC, p.Phe342HisfsX28), S341P (c.1021T>C, p.Ser341Pro), R347H (c.1040G>A, p.Arg347His), R347P (c.1040G>C, p.Arg347Pro), R352Q (c.1055G>A, p.Arg352Gln), 1213delT (c.1081delT, p.Trp361GlyfsX8), 1248+1G>A (c.1116+1G>A), 1259insA (c.1127_1128insA, p.Gln378AlafsX4), W401X (c.1202G>A)(c.1202G>A, p.Trp401X), W401X (c.1203G>A) (c.1203G>A, p.Trp401X), 1341+1G>A (c.1209+1G>A), 1461ins4 (c.1329_1330insAGAT, p.Ile444ArgfsX3), A455E (c.1364C>A, p.Ala455Glu), 1525-1G>A (c.1393-1G>A), S466X (C>A) (c.1397C>A, p.Ser466X), S466X (C>G) (c.1397C>G, p.Ser466X), L467P (c.1400T>C, p.Leu467Pro), 1548delG (c.1418delG, p.Gly473GlufsX54), S489X (c.1466C>A, p.Ser489X), S492F (c.1475C>T, p.Ser492Phe), Q493X (c.1477C>T, p.Gln493X), I507del (c.1519_1521delATC, p.Ile507del), F508del (c.1521_1523delCTT, p.Phe508del), 1677delTA (c.1545_1546delTA, p.Tyr515X), V520F (c.1558G>T, p.Val520Phe), Q525X (c.1573C>T, p.Gln525X), 1717-8G>A (c.1585-8G>A), 1717-1G>A (c.1585-1G>A), G542X (c.1624G>T, p.Gly542X), S549R (c.1645A>C) (c.1645A>C, p.Ser549Arg), S549R (c.1647T>G) (c.1647T>G, p.Ser549Arg), S549N (c.1646G>A, p.Ser549Asn), G551D (c.1652G>A, p.Gly551Asp), Q552X (c.1654C>T, p.Gln552X), R553X (c.1657C>T, p.Arg553X), A559T (c.1675G>A, p.Ala559Thr), R560T (c.1679G>C, p.Arg560Thr), R560K (c.1679G>A, p.Arg560Lys), 1811+1.6kbA>G (c.1679+1.6kbA>G), 1812-1G>A (c.1680-1G>A), E585X (c.1753G>T, p.Glu585X), 1898+1G>A (c.1766+1G>A), 1898+3A>G (c.1766+3A>G), 2143delT (c.2012delT, p.Leu671X), R709X (c.2125C>T, p.Arg709X), K710X (c.2128A>T, p.Lys710X), 2183AA>G (c.2051_2052delAAinsG, p.Lys684SerfsX38), 2184insA (c.2052_2053insA, p.Gln685ThrfsX4), 2184delA (c.2052delA, p.Lys684AsnfsX38), 2307insA (c.2175_2176insA, p.Glu726ArgfsX4), L732X (c.2195T>G, p.Leu732X), 2347delG (c.2215delG, p.Val739TyrfsX16), R764X (c.2290C>T, p.Arg764X), 2585delT (c.2453delT, p.Leu818TrpfsX3), E822X (c.2464G>T, p.Glu822X), 2622+1G>A (c.2490+1G>A), E831X (c.2491G>T, p.Glu831X), W846X (c.2537G>A, p.Trp846X), R851X (c.2551C>T, p.Arg851X),  2711delT (c.2583delT, p.Phe861LeufsX3), 2789+5G>A (c.2657+5G>A), Q890X (c.2668C>T, p.Gln890X), L927P (c.2780T>C, p.Leu927Pro), S945L (c.2834C>T, p.Ser945Leu), 3007delG (c.2875delG, p.Ala959HisfsX9), G970R (c.2908G>C, p.Gly970Arg), 3120G>A (c.2988G>A, p.Gln996=), 3120+1G>A (c.2988+1G>A), 3121-1G>A (c.2989-1G>A), 3272-26A>G (c.3140-26A>G), L1065P (c.3194T>C, p.Leu1065Pro), R1066C (c.3196C>T, p.Arg1066Cys), R1066H (c.3197G>A, p.Arg1066His), L1077P (c.3230T>C, p.Leu1077Pro), W1089X (c.3266G>A, p.Trp1089X), Y1092X (C>A) (c.3276C>A, p.Tyr1092X), Y1092X (C>G) (c.3276C>G, p.Tyr1092X), M1101K (c.3302T>A, p.Met1101Lys), E1104X (c.3310G>T, p.Glu1104X), R1158X (c.3472C>T, p.Arg1158X), R1162X (c.3484C>T, p.Arg1162X), 3659delC (c.3528delC, p.Lys1177SerfsX15), S1196X (c.3587C>G, p.Ser1196X), W1204X (c.3611G>A) (c.3611G>A, p.Trp1204X), W1204X (c.3612G>A) (c.3612G>A, p.Trp1204X), 3791delC (c.3659delC, p.Thr1220LysfsX8), 3849+10kbC>T (c.3717+12191C>T), G1244E (c.3731G>A, p.Gly1244Glu), 3876delA (c.3744delA, p.Lys1250ArgfsX9), S1251N (c.3752G>A, p.Ser1251Asn), 3905insT (c.3773_3774insT, p.Leu1258PhefsX7), W1282X (c.3846G>A, p.Trp1282X), 4005+1G>A (c.3873+1G>A), N1303K (c.3909C>G, p.Asn1303Lys), 4016insT (c.3884_3885insT, p.Ser1297PhefsX5), Q1313X (c.3937C>T, p.Gln1313X),  4209TGTT>AA (c.4077_4080delTGTTinsAA, p.Val1360Thrfs), CFTRdele22,23 (c.3964-78_4242+577del), 4382delA (c.4251delA, p.Glu1418ArgfsX14), Reported only if sample has homozygous F508del or I507del: I506V (c.1516A>G, p.Ile506Val), I507V (c.1519A>G, p.Ile507Val), F508C (c.1523T>G, p.Phe508Cys), Reported only if the R117H variation is identified for a sample: PolyTG/PolyT.

Interpretive Data and Information

The gene tested in this assay has been found to be altered in the manifestation of many diseases and conditions. The manifestation of disease is commonly caused by many genes and other variables not addressed in this report, including but not limited to modifier genes, epigenetic factors, environmental factors, and factors that are not known at this time. This report must always be interpreted and considered within the clinical context, and the treating physician(s) should always consider other pertinent information and data that a physician would prudently consider, in addition to the variants identified in this report.

The information contained in this report was created based on findings in scientific manuscripts, references, and publicly available databases that describe correlations between certain genetic variants and disease. This information is subject to change over time in response to future scientific and medical findings and correlations. The University of Pennsylvania Health System (UPHS) makes no representation or warranty of any kind regarding the accuracy of information provided or contained in these manuscripts, references or other sources of information. If any of the information provided by or contained in the referenced materials is later deemed to be inaccurate, this may impact the accuracy of this report and interpretation of the findings. UPHS will not be able to notify you of any impact that additional or modified information, or future scientific or medical research may have on this report. The variants and findings identified in this report must always be interpreted and considered within the clinical context and other pertinent data.

The information, interpretations, and conclusions contained in this report are provided on an “AS IS” basis. UPHS makes no representation or warranty of any kind, expressed or implied, regarding the information, interpretations, and conclusions contained in this report. In no event will UPHS be liable for any actual damages, indirect damages, and/or special or consequential damages arising out of or in any way connected with use of this report.

This assay is designed to detect a specific subset of variants in CFTR. The assay only reports amino acid level changes if they are associated with the nucleotide changes as listed below. While other nucleotide level changes can lead to the same amino acid level changes, these will not be reported by the assay. The presence of other variants in CFTR is not determined by this assay and failure to identify a variant does not guarantee that other CFTR variants are not present. When applicable, variant zygosity is reported as heterozygous or homozygous, however variant allele fraction (defined as the proportion of variant reads at a given locus) is not reported. This assay does not determine variant causality or whether a variant was inherited. As with any hybridization-based assay, underlying polymorphisms or variants in oligonucleotide-binding regions can affect the alleles being probed and, consequently, the result. This assay cannot guarantee all regions will meet variant calling criteria due to technical limitations of the assay and the possibility of underlying genomic changes. 

Four variants on this assay (PolyTG/PolyT, p.I506V, p.I507V and p.F508C) are reported in selected contexts only (see Method). If clinically indicated, alternative testing may be pursued to obtain results for these variants outside of the contexts in which they are reported in this assay.

This assay cannot determine the phasing (i.e., cis/trans) of the PolyTG/PolyT variant with respect to the R117H variant. Familial genotyping studies may be performed if clinically indicated to assist with determining phasing. PolyTG/PolyT variants are homopolymeric regions known to be difficult to interpret with NGS sequence-based assays due to polymerase slippage. Thus, the length reported for the PolyTG/PolyT variant may vary from the actual length by ±1 bp.

The gene tested in this assay has been found to be altered in the manifestation of multiple diseases and conditions. The manifestation of disease is commonly caused by many genes and other variables not addressed in this report, including but not limited to modifier genes, epigenetic factors, environmental factors, and factors that are not known at this time. Variant detection should not be equated with disease. This report is relevant only in its interpretation based on the context of the patient’s clinical manifestations. 

Clinical Significance

Disease-associated sequence variants in CFTR can be identified in carriers as well as individuals with cystic fibrosis (CF) and other CFTR-related disorders such as congenital absence of the vas deferens and pancreatitis. Disease phenotype is dependent on the CFTR variant(s) identified, the zygosity of the variants, as well as other factors. Individuals clinically diagnosed with CF, a recessively inherited disease, typically have two CFTR disease-associated variants (i.e., homozygous or compound heterozygous). Individuals with CFTR-related disorders can harbor various CFTR genotypes including the presence of only one severe CFTR disease-associated variant or two non-severe CFTR variants, among other possibilities. If the clinical suspicion of CF or other CFTR-related disorders is high in the setting of a not detected result, this patient may be affected with rare disease-associated variants of the CFTR gene that are not detected by this panel. If clinically indicated, additional testing for CFTR variants not included in this assay may be appropriate.

CPT Codes

81220, G0452

LOINC

  • 21654-9
  • 21656-4
  • 42939-9
  • 42938-1
Collection & Processing

Ordering Recommendations

If there is a known family history of a CFTR variant, please provide this information. 

If evaluating a patient for diagnostic testing (e.g. symptomatic cystic fibrosis, pancreatitis, CAVD), please provide relevant clinical information about symptoms.

Collection Container

Collect

2 ml whole blood, lavender (EDTA) top tube

Pediatric Collection

Approval required from Molecular Pathologist for Pediatric Testing; contact the Molecular Laboratory at 215-615-3094 to arrange testing.

Specimen Preparation

Do not spin or separate.

Storage/Transport Temperature

Room Temperature

Stability (from collection to initiation)

Stable at room temperature for 7 days, and refrigerated for 30 days.

Unacceptable Conditions

Clotted, hemolyzed, heparinized, frozen, or mislabeled specimens.

Remarks

For carrier screening in adults of reproductive age, for confirmatory diagnostic testing of newborns and children, or for an initial test to aid in the diagnosis of individuals with suspected cystic fibrosis: The performance characteristics of this test were verified by the Molecular Pathology Laboratory in the Department of Pathology and Laboratory Medicine at the Hospital of the University of Pennsylvania, 3400 Spruce St., Philadelphia, PA 19104. This test has been cleared by the FDA.

For all other patients not included above: This test was developed, and its performance characteristics determined by the Molecular Pathology Laboratory in the Department of Pathology and Laboratory Medicine in the University of Pennsylvania Health System at the Hospital of the University of Pennsylvania 3400 Spruce Street, Philadelphia, PA 19104. It has not been cleared or approved by the US Food and Drug Administration (FDA) for certain indications. The FDA does not require this test to go through premarket FDA review.  This test is used for clinical purposes. It should not be regarded as investigational or for research. This laboratory is certified under the Clinical Laboratory Improvement Amendments (CLIA) as qualified to perform high complexity clinical laboratory testing.
CR&P Information

Processing - HUP

Do not spin or separate. If necessary, order in Cerner and place a barcoded sticker on the sample. Place the sample in the Molecular Pathology bin.

Processing - PAH

Prepare specimen for courier pickup.
Result Interpretation

Reference Interval

Variant not detected

Interpretive Data

VARIANTS DETECTED BY THIS ASSAY: Colloquial nomenclature for CFTR variants:
Colloquial nomenclature for CFTR mutations is followed parenthetically by standardized nomenclature based on Embank cDNA reference sequence NM_000492.3 and protein reference sequence NP_000483.3.
M1V (c.1A>G,p.Met1Val), CFTRdele2,3 (c.54-5940_273+10250del21kb, p.Ser18ArgfsX16), Q39X (c.115C>T, p.Gln39X), E60X (c.178G>T, p.Glu60X), P67L (c.200C>T, p.Pro67Leu), R75X (c.223C>T, p.Arg75X), G85E (c.254G>A, p.Gly85Glu), 394delTT (c.262_263delTT, p.Leu88IlefsX22), 405+1G>A (c.273+1G>A), 406-1G>A (c.274-1G>A), E92X (c.274G>T, p.Glu92X), E92K (c.274G>A, p.Glu92Lys), Q98X (c.292C>T, p.Gln98X), 457TAT>G (c.325_327delTATinsG, p.Tyr109GlyfsX4), D110H (c.328G>C, p.Asp110His), R117C (c.349C>T, p.Arg117Cys), R117H (c.350G>A, p.Arg117His), Y122X (c.366T>A, p.Tyr122X), 574delA (c.442delA, p.Ile148LeufsX5), 621+1G>T (c.489+1G>T), 663delT (c.531delT, p.Ile177MetfsX12), G178R (c.532G>A, p.Gly178Arg), 711+1G>T (c.579+1G>T), 711+3A>G (c.579+3A>G), 711+5G>A (c.579+5G>A), 712-1G>T (c.580-1G>T), H199Y (c.595C>T, p.His199Tyr), P205S (c.613C>T, p.Pro205Ser), L206W (c.617T>G, p.Leu206Trp), Q220X (c.658C>T, p.Gln220X), 852del22 (c.720_741delAGGGAGAATGATGATGAAGTAC, p.Gly241GlufsX13), 1078delT (c.948delT, p.Phe316LeufsX12), G330X (c.988G>T, p.Gly330X), R334W (c.1000C>T, p.Arg334Trp), I336K (c.1007T>A, p.Ile336Lys), T338I (c.1013C>T, p.Thr338Ile), 1154insTC (c.1022_1023insTC, p.Phe342HisfsX28), S341P (c.1021T>C, p.Ser341Pro), R347H (c.1040G>A, p.Arg347His), R347P (c.1040G>C, p.Arg347Pro), R352Q (c.1055G>A, p.Arg352Gln), 1213delT (c.1081delT, p.Trp361GlyfsX8), 1248+1G>A (c.1116+1G>A), 1259insA (c.1127_1128insA, p.Gln378AlafsX4), W401X (c.1202G>A)(c.1202G>A, p.Trp401X), W401X (c.1203G>A) (c.1203G>A, p.Trp401X), 1341+1G>A (c.1209+1G>A), 1461ins4 (c.1329_1330insAGAT, p.Ile444ArgfsX3), A455E (c.1364C>A, p.Ala455Glu), 1525-1G>A (c.1393-1G>A), S466X (C>A) (c.1397C>A, p.Ser466X), S466X (C>G) (c.1397C>G, p.Ser466X), L467P (c.1400T>C, p.Leu467Pro), 1548delG (c.1418delG, p.Gly473GlufsX54), S489X (c.1466C>A, p.Ser489X), S492F (c.1475C>T, p.Ser492Phe), Q493X (c.1477C>T, p.Gln493X), I507del (c.1519_1521delATC, p.Ile507del), F508del (c.1521_1523delCTT, p.Phe508del), 1677delTA (c.1545_1546delTA, p.Tyr515X), V520F (c.1558G>T, p.Val520Phe), Q525X (c.1573C>T, p.Gln525X), 1717-8G>A (c.1585-8G>A), 1717-1G>A (c.1585-1G>A), G542X (c.1624G>T, p.Gly542X), S549R (c.1645A>C) (c.1645A>C, p.Ser549Arg), S549R (c.1647T>G) (c.1647T>G, p.Ser549Arg), S549N (c.1646G>A, p.Ser549Asn), G551D (c.1652G>A, p.Gly551Asp), Q552X (c.1654C>T, p.Gln552X), R553X (c.1657C>T, p.Arg553X), A559T (c.1675G>A, p.Ala559Thr), R560T (c.1679G>C, p.Arg560Thr), R560K (c.1679G>A, p.Arg560Lys), 1811+1.6kbA>G (c.1679+1.6kbA>G), 1812-1G>A (c.1680-1G>A), E585X (c.1753G>T, p.Glu585X), 1898+1G>A (c.1766+1G>A), 1898+3A>G (c.1766+3A>G), 2143delT (c.2012delT, p.Leu671X), R709X (c.2125C>T, p.Arg709X), K710X (c.2128A>T, p.Lys710X), 2183AA>G (c.2051_2052delAAinsG, p.Lys684SerfsX38), 2184insA (c.2052_2053insA, p.Gln685ThrfsX4), 2184delA (c.2052delA, p.Lys684AsnfsX38), 2307insA (c.2175_2176insA, p.Glu726ArgfsX4), L732X (c.2195T>G, p.Leu732X), 2347delG (c.2215delG, p.Val739TyrfsX16), R764X (c.2290C>T, p.Arg764X), 2585delT (c.2453delT, p.Leu818TrpfsX3), E822X (c.2464G>T, p.Glu822X), 2622+1G>A (c.2490+1G>A), E831X (c.2491G>T, p.Glu831X), W846X (c.2537G>A, p.Trp846X), R851X (c.2551C>T, p.Arg851X),  2711delT (c.2583delT, p.Phe861LeufsX3), 2789+5G>A (c.2657+5G>A), Q890X (c.2668C>T, p.Gln890X), L927P (c.2780T>C, p.Leu927Pro), S945L (c.2834C>T, p.Ser945Leu), 3007delG (c.2875delG, p.Ala959HisfsX9), G970R (c.2908G>C, p.Gly970Arg), 3120G>A (c.2988G>A, p.Gln996=), 3120+1G>A (c.2988+1G>A), 3121-1G>A (c.2989-1G>A), 3272-26A>G (c.3140-26A>G), L1065P (c.3194T>C, p.Leu1065Pro), R1066C (c.3196C>T, p.Arg1066Cys), R1066H (c.3197G>A, p.Arg1066His), L1077P (c.3230T>C, p.Leu1077Pro), W1089X (c.3266G>A, p.Trp1089X), Y1092X (C>A) (c.3276C>A, p.Tyr1092X), Y1092X (C>G) (c.3276C>G, p.Tyr1092X), M1101K (c.3302T>A, p.Met1101Lys), E1104X (c.3310G>T, p.Glu1104X), R1158X (c.3472C>T, p.Arg1158X), R1162X (c.3484C>T, p.Arg1162X), 3659delC (c.3528delC, p.Lys1177SerfsX15), S1196X (c.3587C>G, p.Ser1196X), W1204X (c.3611G>A) (c.3611G>A, p.Trp1204X), W1204X (c.3612G>A) (c.3612G>A, p.Trp1204X), 3791delC (c.3659delC, p.Thr1220LysfsX8), 3849+10kbC>T (c.3717+12191C>T), G1244E (c.3731G>A, p.Gly1244Glu), 3876delA (c.3744delA, p.Lys1250ArgfsX9), S1251N (c.3752G>A, p.Ser1251Asn), 3905insT (c.3773_3774insT, p.Leu1258PhefsX7), W1282X (c.3846G>A, p.Trp1282X), 4005+1G>A (c.3873+1G>A), N1303K (c.3909C>G, p.Asn1303Lys), 4016insT (c.3884_3885insT, p.Ser1297PhefsX5), Q1313X (c.3937C>T, p.Gln1313X),  4209TGTT>AA (c.4077_4080delTGTTinsAA, p.Val1360Thrfs), CFTRdele22,23 (c.3964-78_4242+577del), 4382delA (c.4251delA, p.Glu1418ArgfsX14), Reported only if sample has homozygous F508del or I507del: I506V (c.1516A>G, p.Ile506Val), I507V (c.1519A>G, p.Ile507Val), F508C (c.1523T>G, p.Phe508Cys), Reported only if the R117H variation is identified for a sample: PolyTG/PolyT.

Interpretive Data and Information

The gene tested in this assay has been found to be altered in the manifestation of many diseases and conditions. The manifestation of disease is commonly caused by many genes and other variables not addressed in this report, including but not limited to modifier genes, epigenetic factors, environmental factors, and factors that are not known at this time. This report must always be interpreted and considered within the clinical context, and the treating physician(s) should always consider other pertinent information and data that a physician would prudently consider, in addition to the variants identified in this report.

The information contained in this report was created based on findings in scientific manuscripts, references, and publicly available databases that describe correlations between certain genetic variants and disease. This information is subject to change over time in response to future scientific and medical findings and correlations. The University of Pennsylvania Health System (UPHS) makes no representation or warranty of any kind regarding the accuracy of information provided or contained in these manuscripts, references or other sources of information. If any of the information provided by or contained in the referenced materials is later deemed to be inaccurate, this may impact the accuracy of this report and interpretation of the findings. UPHS will not be able to notify you of any impact that additional or modified information, or future scientific or medical research may have on this report. The variants and findings identified in this report must always be interpreted and considered within the clinical context and other pertinent data.

The information, interpretations, and conclusions contained in this report are provided on an “AS IS” basis. UPHS makes no representation or warranty of any kind, expressed or implied, regarding the information, interpretations, and conclusions contained in this report. In no event will UPHS be liable for any actual damages, indirect damages, and/or special or consequential damages arising out of or in any way connected with use of this report.

This assay is designed to detect a specific subset of variants in CFTR. The assay only reports amino acid level changes if they are associated with the nucleotide changes as listed below. While other nucleotide level changes can lead to the same amino acid level changes, these will not be reported by the assay. The presence of other variants in CFTR is not determined by this assay and failure to identify a variant does not guarantee that other CFTR variants are not present. When applicable, variant zygosity is reported as heterozygous or homozygous, however variant allele fraction (defined as the proportion of variant reads at a given locus) is not reported. This assay does not determine variant causality or whether a variant was inherited. As with any hybridization-based assay, underlying polymorphisms or variants in oligonucleotide-binding regions can affect the alleles being probed and, consequently, the result. This assay cannot guarantee all regions will meet variant calling criteria due to technical limitations of the assay and the possibility of underlying genomic changes. 

Four variants on this assay (PolyTG/PolyT, p.I506V, p.I507V and p.F508C) are reported in selected contexts only (see Method). If clinically indicated, alternative testing may be pursued to obtain results for these variants outside of the contexts in which they are reported in this assay.

This assay cannot determine the phasing (i.e., cis/trans) of the PolyTG/PolyT variant with respect to the R117H variant. Familial genotyping studies may be performed if clinically indicated to assist with determining phasing. PolyTG/PolyT variants are homopolymeric regions known to be difficult to interpret with NGS sequence-based assays due to polymerase slippage. Thus, the length reported for the PolyTG/PolyT variant may vary from the actual length by ±1 bp.

The gene tested in this assay has been found to be altered in the manifestation of multiple diseases and conditions. The manifestation of disease is commonly caused by many genes and other variables not addressed in this report, including but not limited to modifier genes, epigenetic factors, environmental factors, and factors that are not known at this time. Variant detection should not be equated with disease. This report is relevant only in its interpretation based on the context of the patient’s clinical manifestations. 

Clinical Significance

Disease-associated sequence variants in CFTR can be identified in carriers as well as individuals with cystic fibrosis (CF) and other CFTR-related disorders such as congenital absence of the vas deferens and pancreatitis. Disease phenotype is dependent on the CFTR variant(s) identified, the zygosity of the variants, as well as other factors. Individuals clinically diagnosed with CF, a recessively inherited disease, typically have two CFTR disease-associated variants (i.e., homozygous or compound heterozygous). Individuals with CFTR-related disorders can harbor various CFTR genotypes including the presence of only one severe CFTR disease-associated variant or two non-severe CFTR variants, among other possibilities. If the clinical suspicion of CF or other CFTR-related disorders is high in the setting of a not detected result, this patient may be affected with rare disease-associated variants of the CFTR gene that are not detected by this panel. If clinically indicated, additional testing for CFTR variants not included in this assay may be appropriate.
Billing Codes

CPT Codes

81220, G0452

LOINC

  • 21654-9
  • 21656-4
  • 42939-9
  • 42938-1

Ordering Information

Cerner Orderable
CFPLUS
Penn Chart Orderable
Cystic Fibrosis - CFTR 139 Variant Analysis; C2008401
Performing Lab
Molecular Pathology
Performed
Batched Weekly
Reported
7-10 Days
Methodology
Next Generation Sequencing utilizing Illumina MiSeqDx
Synonyms
  • CAVD
  • Pancreatitis
  • CFTR
  • Cystic fibrosis