Ordering Recommendations

If there is a known family history of a CFTR variant, please provide this information. 

If evaluating a patient for diagnostic testing (e.g. symptomatic cystic fibrosis, pancreatitis, CAVD), please provide relevant clinical information about symptoms.

Collection Container

Collect

2 ml whole blood, lavender (EDTA) top tube

Pediatric Collection

Approval required from Molecular Pathologist for Pediatric Testing; contact the Molecular Laboratory at 215-662-6121 to arrange testing.

Storage/Transport Temperature

Room Temperature

Stability (from collection to initiation)

Stable at room temperature for 24 hours, and refrigerated for 5 days.

Unacceptable Conditions

Specimens older than 72 hours; Clotted, hemolyzed, heparinized, frozen, or mislabeled specimens.

Remarks

For carrier screening in adults of reproductive age, for confirmatory diagnostic testing of newborns and children, or for an initial test to aid in the diagnosis of individuals with suspected cystic fibrosis: The performance characteristics of this test were verified by the Molecular Pathology Laboratory in the Department of Pathology and Laboratory Medicine at the Hospital of the University of Pennsylvania, 3400 Spruce St., Philadelphia, PA 19104.  This test has been cleared by the FDA.

For all other patients not included above: This test was developed and its performance characteristics determined by the Molecular Pathology Laboratory in the Department of Pathology and Laboratory Medicine in the University of Pennsylvania Health System at the Hospital of the University of Pennsylvania 3400 Spruce Street, Philadelphia, PA 19104.  It has not been cleared or approved by the US Food and Drug Administration (FDA) for certain indications.  The FDA does not require this test to go through premarket FDA review.  This test is used for clinical purposes.  It should not be regarded as investigational or for research.  This laboratory is certified under the Clinical Laboratory Improvement Amendments (CLIA) as qualified to perform high complexity clinical laboratory testing.

Processing - HUP

Do not spin or separate. If necessary, order in Cerner and place a barcoded sticker on the sample. Place the sample in the Molecular Pathology bin.

Processing - PAH

Prepare specimen for courier pickup.

Reference Interval

Variant not detected

Interpretive Data

MUTATIONS DETECTED BY THIS ASSAY:
Colloquial nomenclature for CFTR mutations is followed parenthetically by standardized nomenclature based on Embank cDNA reference sequence NM_000492.3 and protein reference sequence NP_000483.3.
M1V (c.1A>G,p.Met1Val), CFTRdele2,3 (c.54-5940_273+10250del21kb, p.Ser18ArgfsX16), Q39X (c.115C>T, p.Gln39X), E60X (c.178G>T, p.Glu60X), P67L (c.200C>T, p.Pro67Leu), R75X (c.223C>T, p.Arg75X), G85E (c.254G>A, p.Gly85Glu), 394delTT (c.262_263delTT, p.Leu88IlefsX22), 405+1G>A (c.273+1G>A), 406-1G>A (c.274-1G>A), E92X (c.274G>T, p.Glu92X), E92K (c.274G>A, p.Glu92Lys), Q98X (c.292C>T, p.Gln98X), 457TAT>G (c.325_327delTATinsG, p.Tyr109GlyfsX4), D110H (c.328G>C, p.Asp110His), R117C (c.349C>T, p.Arg117Cys), R117H (c.350G>A, p.Arg117His), Y122X (c.366T>A, p.Tyr122X), 574delA (c.442delA, p.Ile148LeufsX5), 621+1G>T (c.489+1G>T), 663delT (c.531delT, p.Ile177MetfsX12), G178R (c.532G>A, p.Gly178Arg), 711+1G>T (c.579+1G>T), 711+3A>G (c.579+3A>G), 711+5G>A (c.579+5G>A), 712-1G>T (c.580-1G>T), H199Y (c.595C>T, p.His199Tyr), P205S (c.613C>T, p.Pro205Ser), L206W (c.617T>G, p.Leu206Trp), Q220X (c.658C>T, p.Gln220X), 852del22 (c.720_741delAGGGAGAATGATGATGAAGTAC, p.Gly241GlufsX13), 1078delT (c.948delT, p.Phe316LeufsX12), G330X (c.988G>T, p.Gly330X), R334W (c.1000C>T, p.Arg334Trp), I336K (c.1007T>A, p.Ile336Lys), T338I (c.1013C>T, p.Thr338Ile), 1154insTC (c.1022_1023insTC, p.Phe342HisfsX28), S341P (c.1021T>C, p.Ser341Pro), R347H (c.1040G>A, p.Arg347His), R347P (c.1040G>C, p.Arg347Pro), R352Q (c.1055G>A, p.Arg352Gln), 1213delT (c.1081delT, p.Trp361GlyfsX8), 1248+1G>A (c.1116+1G>A), 1259insA (c.1127_1128insA, p.Gln378AlafsX4), W401X (c.1202G>A)(c.1202G>A, p.Trp401X), W401X (c.1203G>A) (c.1203G>A, p.Trp401X), 1341+1G>A (c.1209+1G>A), 1461ins4 (c.1329_1330insAGAT, p.Ile444ArgfsX3), A455E (c.1364C>A, p.Ala455Glu), 1525-1G>A (c.1393-1G>A), S466X (C>A) (c.1397C>A, p.Ser466X), S466X (C>G) (c.1397C>G, p.Ser466X), L467P (c.1400T>C, p.Leu467Pro), 1548delG (c.1418delG, p.Gly473GlufsX54), S489X (c.1466C>A, p.Ser489X), S492F (c.1475C>T, p.Ser492Phe), Q493X (c.1477C>T, p.Gln493X), I507del (c.1519_1521delATC, p.Ile507del), F508del (c.1521_1523delCTT, p.Phe508del), 1677delTA (c.1545_1546delTA, p.Tyr515X), V520F (c.1558G>T, p.Val520Phe), Q525X (c.1573C>T, p.Gln525X), 1717-8G>A (c.1585-8G>A), 1717-1G>A (c.1585-1G>A), G542X (c.1624G>T, p.Gly542X), S549R (c.1645A>C) (c.1645A>C, p.Ser549Arg), S549R (c.1647T>G) (c.1647T>G, p.Ser549Arg), S549N (c.1646G>A, p.Ser549Asn), G551D (c.1652G>A, p.Gly551Asp), Q552X (c.1654C>T, p.Gln552X), R553X (c.1657C>T, p.Arg553X), A559T (c.1675G>A, p.Ala559Thr), R560T (c.1679G>C, p.Arg560Thr), R560K (c.1679G>A, p.Arg560Lys), 1811+1.6kbA>G (c.1679+1.6kbA>G), 1812-1G>A (c.1680-1G>A), E585X (c.1753G>T, p.Glu585X), 1898+1G>A (c.1766+1G>A), 1898+3A>G (c.1766+3A>G), 2143delT (c.2012delT, p.Leu671X), R709X (c.2125C>T, p.Arg709X), K710X (c.2128A>T, p.Lys710X), 2183AA>G (c.2051_2052delAAinsG, p.Lys684SerfsX38), 2184insA (c.2052_2053insA, p.Gln685ThrfsX4), 2184delA (c.2052delA, p.Lys684AsnfsX38), 2307insA (c.2175_2176insA, p.Glu726ArgfsX4), L732X (c.2195T>G, p.Leu732X), 2347delG (c.2215delG, p.Val739TyrfsX16), R764X (c.2290C>T, p.Arg764X), 2585delT (c.2453delT, p.Leu818TrpfsX3), E822X (c.2464G>T, p.Glu822X), 2622+1G>A (c.2490+1G>A), E831X (c.2491G>T, p.Glu831X), W846X (c.2537G>A, p.Trp846X), R851X (c.2551C>T, p.Arg851X),  2711delT (c.2583delT, p.Phe861LeufsX3), 2789+5G>A (c.2657+5G>A), Q890X (c.2668C>T, p.Gln890X), L927P (c.2780T>C, p.Leu927Pro), S945L (c.2834C>T, p.Ser945Leu), 3007delG (c.2875delG, p.Ala959HisfsX9), G970R (c.2908G>C, p.Gly970Arg), 3120G>A (c.2988G>A, p.Gln996=), 3120+1G>A (c.2988+1G>A), 3121-1G>A (c.2989-1G>A), 3272-26A>G (c.3140-26A>G), L1065P (c.3194T>C, p.Leu1065Pro), R1066C (c.3196C>T, p.Arg1066Cys), R1066H (c.3197G>A, p.Arg1066His), L1077P (c.3230T>C, p.Leu1077Pro), W1089X (c.3266G>A, p.Trp1089X), Y1092X (C>A) (c.3276C>A, p.Tyr1092X), Y1092X (C>G) (c.3276C>G, p.Tyr1092X), M1101K (c.3302T>A, p.Met1101Lys), E1104X (c.3310G>T, p.Glu1104X), R1158X (c.3472C>T, p.Arg1158X), R1162X (c.3484C>T, p.Arg1162X), 3659delC (c.3528delC, p.Lys1177SerfsX15), S1196X (c.3587C>G, p.Ser1196X), W1204X (c.3611G>A) (c.3611G>A, p.Trp1204X), W1204X (c.3612G>A) (c.3612G>A, p.Trp1204X), 3791delC (c.3659delC, p.Thr1220LysfsX8), 3849+10kbC>T (c.3717+12191C>T), G1244E (c.3731G>A, p.Gly1244Glu), 3876delA (c.3744delA, p.Lys1250ArgfsX9), S1251N (c.3752G>A, p.Ser1251Asn), 3905insT (c.3773_3774insT, p.Leu1258PhefsX7), W1282X (c.3846G>A, p.Trp1282X), 4005+1G>A (c.3873+1G>A), N1303K (c.3909C>G, p.Asn1303Lys), 4016insT (c.3884_3885insT, p.Ser1297PhefsX5), Q1313X (c.3937C>T, p.Gln1313X),  4209TGTT>AA (c.4077_4080delTGTTinsAA, p.Val1360Thrfs), CFTRdele22,23 (c.3964-78_4242+577del), 4382delA (c.4251delA, p.Glu1418ArgfsX14), Reported only if sample has homozygous F508del or I507del: I506V (c.1516A>G, p.Ile506Val), I507V (c.1519A>G, p.Ile507Val), F508C (c.1523T>G, p.Phe508Cys), Reported only if the R117H variation is identified for a sample: PolyTG/PolyT.

Interpretive Data and Information

The gene tested in this assay has been found to be altered in the manifestation of many diseases and conditions. The manifestation of disease is commonly caused by many genes and other variables not addressed in this report, including but not limited to modifier genes, epigenetic factors, environmental factors, and factors that are not known at this time. This report must always be interpreted and considered within the clinical context, and the treating physician(s) should always consider other pertinent information and data that a physician would prudently consider, in addition to the variants identified in this report.

This report has been created based on various scientific manuscripts, references and publicly available databases that describe correlations between certain genetic variants and disease. This information is subject to change over time in response to future scientific and medical findings. The University of Pennsylvania Health System (UPHS) makes no representation or warranty of any kind regarding the accuracy of information provided or contained in these manuscripts, references or other sources of information. If any of the information provided by or contained in the referenced material is later deemed to be inaccurate, this may impact the accuracy of this report and interpretation of the findings. In addition, UPHS is not obligated to update this report based on any future scientific or medical research which may impact the interpretation of this report. In no event will UPHS be liable for any actual damages, indirect damages, and/or special or consequential damages arising out of or in any way connected with the use of this report.

This assay is designed to detect a specific subset of variants in CFTR. The presence of other variants in CFTR is not determined by this assay and failure to identify a variant does not guarantee that other CFTR variants are not present. When applicable, variant zygosity is reported as heterozygous or homozygous, however variant allele fraction (defined as the proportion of variant reads at a given locus) is not reported. This assay does not determine variant causality or whether a variant is inherited. As with any hybridization-based assay, underlying polymorphisms or variants in oligonucleotide-binding regions can affect the alleles being probed and, consequently, the calls made. This assay cannot guarantee all regions will meet variant calling criteria due to technical limitations of the assay and the possibility of underlying genomic changes.

Four variants on this assay (PolyTG/PolyT, p.Ile506Val, p.Ile507Val, p.Phe508Cys) are reported in selected contexts only. If clinically indicated, alternative testing may be pursued to obtain genotype results for these variants outside of the contexts in which they are reported in this assay.

This assay cannot determine whether the orientation of the PolyTG/PolyT variant is in cis/trans with respect to the p.Arg117His variant. Familial genotyping studies may be performed if clinically indicated to assist with determining phasing of the p.Arg117His and PolyTG/PolyT variants.  PolyTG/PolyT variants are homopolymeric regions known to be difficult to interpret with NGS sequence-based assays due to polymerase slippage. Thus the length reported for the PolyTG/PolyT variant may vary from the actual length by ±1 bp.

This test is not indicated for use for newborn screening, fetal diagnostic testing, pre-implantation testing, or for standalone diagnostic purposes.

Clinical Significance

Disease-associated sequence variants in CFTR are identified in individuals with cystic fibrosis (CF) and other CFTR-related disorders such as congenital absence of the vas deferens (CAVD) and pancreatitis. Disease phenotype is dependent on the CFTR variant(s) identified, the zygosity of the variants, as well as other factors. Clinical diagnosis of CF, a recessively inherited disease, requires the presence of two CFTR disease-associated variants (i.e. homozygous or compound heterozygous), while CAVD and pancreatitis can be seen in the setting of a single (i.e heterozygous) CFTR disease-associated variant. If clinically indicated, additional testing for CFTR variants not included in this assay may be appropriate.

News and Updates

To:       UPHS Physicians and Staff
From: The Division of Precision and Computational Diagnostics (PCD)
            Vivianna Van Deerlin, M.D., Ph.D., Director, Molecular Pathology Laboratory
            Jacquelyn Roth, Ph.D., Molecular Pathology Laboratory
               
Date:  October 29, 2018
Re: METHOD CHANGE for Cystic fibrosis transmembrane conductance regulator (CFTR) variant analysis

In November 2018, the Molecular Pathology Laboratory will perform CFTR variant analysis using an alternative FDA-cleared, next generation sequencing (NGS) methodology (MiSeqDx Cystic Fibrosis 139-Variant Assay), increasing the number of variants detected from the current 23 to a total of 139. This change in methodology is expected to result in increased detection rates of CFTR variants in our patient population. The 23 variants recommended for CFTR screening by the American College of Medical Genetics and Genomics (ACMG) and the American College of Obstetrics and Gynecology (ACOG) are included in the new assay1,2.
 
Testing Highlights of the MiSeqDx Cystic Fibrosis 139-Variant Assay:
  • Includes 134 cystic fibrosis (CF) disease-associated variants, the p.Arg117His (R117H) variant which is classified as a mutation of varying clinical consequence, the intron 8 PolyTG/PolyT modifying variants, and three benign variants (p.Ile506Val, p.Ile507Val, p.Phe508Cys) conditionally reported only in the context of p.Ile507del (deltaI507) or p.Phe508del (deltaF508) homozygosity
  • The disease-associated variants included have allele frequencies of ≥0.01% in individuals affected with cystic fibrosis.
  • The PolyTG/PolyT variant is conditionally reported ONLY in the setting of a p.Arg117His positive result. Phasing of the PolyTG/PolyT and p.Arg117His (i.e., cis/trans determination) is not performed by this assay.
  • Variants will be reported using the standard Human Genome Variation Society (HGVS) nomenclature.  Colloquial variant names can be found at the bottom of the report.
 
Ordering Information:  
  • The name of the orderable in PennChart is being changed to “Cystic Fibrosis – CFTR 139 Variant Analysis” (PxCode C2008401).
     
    Acceptable Specimens for CFTR Variant Analysis:
  • Peripheral blood collected in an EDTA (lavender) tube is the ONLY acceptable specimen Cystic Fibrosis – CFTR 139 Variant Analysis.
     
    For additional information: Call the Molecular Pathology Laboratory (215-662-6121) weekdays during regular business hours.
     
REFERENCES
  1. Watson, et al. Cystic fibrosis population carrier screening: 2004 revision of American College of Medical Genetics mutation panel. Genet Med. 6(5):387-91, 2004.
  2. Committee on Genetics, American College of Obstetricians and Gynecologists. ACOG Committee Opinion. Number 486, April 2011. Update on carrier screening for cystic fibrosis. Obstet Gynecol. 2011 Apr;117(4):1028-31.

CPT Codes

81220, G0452

LOINC

  • 21654-9
Collection & Processing

Ordering Recommendations

If there is a known family history of a CFTR variant, please provide this information. 

If evaluating a patient for diagnostic testing (e.g. symptomatic cystic fibrosis, pancreatitis, CAVD), please provide relevant clinical information about symptoms.

Collection Container

Collect

2 ml whole blood, lavender (EDTA) top tube

Pediatric Collection

Approval required from Molecular Pathologist for Pediatric Testing; contact the Molecular Laboratory at 215-662-6121 to arrange testing.

Storage/Transport Temperature

Room Temperature

Stability (from collection to initiation)

Stable at room temperature for 24 hours, and refrigerated for 5 days.

Unacceptable Conditions

Specimens older than 72 hours; Clotted, hemolyzed, heparinized, frozen, or mislabeled specimens.

Remarks

For carrier screening in adults of reproductive age, for confirmatory diagnostic testing of newborns and children, or for an initial test to aid in the diagnosis of individuals with suspected cystic fibrosis: The performance characteristics of this test were verified by the Molecular Pathology Laboratory in the Department of Pathology and Laboratory Medicine at the Hospital of the University of Pennsylvania, 3400 Spruce St., Philadelphia, PA 19104.  This test has been cleared by the FDA.

For all other patients not included above: This test was developed and its performance characteristics determined by the Molecular Pathology Laboratory in the Department of Pathology and Laboratory Medicine in the University of Pennsylvania Health System at the Hospital of the University of Pennsylvania 3400 Spruce Street, Philadelphia, PA 19104.  It has not been cleared or approved by the US Food and Drug Administration (FDA) for certain indications.  The FDA does not require this test to go through premarket FDA review.  This test is used for clinical purposes.  It should not be regarded as investigational or for research.  This laboratory is certified under the Clinical Laboratory Improvement Amendments (CLIA) as qualified to perform high complexity clinical laboratory testing.
CR&P Information

Processing - HUP

Do not spin or separate. If necessary, order in Cerner and place a barcoded sticker on the sample. Place the sample in the Molecular Pathology bin.

Processing - PAH

Prepare specimen for courier pickup.
Result Interpretation

Reference Interval

Variant not detected

Interpretive Data

MUTATIONS DETECTED BY THIS ASSAY:
Colloquial nomenclature for CFTR mutations is followed parenthetically by standardized nomenclature based on Embank cDNA reference sequence NM_000492.3 and protein reference sequence NP_000483.3.
M1V (c.1A>G,p.Met1Val), CFTRdele2,3 (c.54-5940_273+10250del21kb, p.Ser18ArgfsX16), Q39X (c.115C>T, p.Gln39X), E60X (c.178G>T, p.Glu60X), P67L (c.200C>T, p.Pro67Leu), R75X (c.223C>T, p.Arg75X), G85E (c.254G>A, p.Gly85Glu), 394delTT (c.262_263delTT, p.Leu88IlefsX22), 405+1G>A (c.273+1G>A), 406-1G>A (c.274-1G>A), E92X (c.274G>T, p.Glu92X), E92K (c.274G>A, p.Glu92Lys), Q98X (c.292C>T, p.Gln98X), 457TAT>G (c.325_327delTATinsG, p.Tyr109GlyfsX4), D110H (c.328G>C, p.Asp110His), R117C (c.349C>T, p.Arg117Cys), R117H (c.350G>A, p.Arg117His), Y122X (c.366T>A, p.Tyr122X), 574delA (c.442delA, p.Ile148LeufsX5), 621+1G>T (c.489+1G>T), 663delT (c.531delT, p.Ile177MetfsX12), G178R (c.532G>A, p.Gly178Arg), 711+1G>T (c.579+1G>T), 711+3A>G (c.579+3A>G), 711+5G>A (c.579+5G>A), 712-1G>T (c.580-1G>T), H199Y (c.595C>T, p.His199Tyr), P205S (c.613C>T, p.Pro205Ser), L206W (c.617T>G, p.Leu206Trp), Q220X (c.658C>T, p.Gln220X), 852del22 (c.720_741delAGGGAGAATGATGATGAAGTAC, p.Gly241GlufsX13), 1078delT (c.948delT, p.Phe316LeufsX12), G330X (c.988G>T, p.Gly330X), R334W (c.1000C>T, p.Arg334Trp), I336K (c.1007T>A, p.Ile336Lys), T338I (c.1013C>T, p.Thr338Ile), 1154insTC (c.1022_1023insTC, p.Phe342HisfsX28), S341P (c.1021T>C, p.Ser341Pro), R347H (c.1040G>A, p.Arg347His), R347P (c.1040G>C, p.Arg347Pro), R352Q (c.1055G>A, p.Arg352Gln), 1213delT (c.1081delT, p.Trp361GlyfsX8), 1248+1G>A (c.1116+1G>A), 1259insA (c.1127_1128insA, p.Gln378AlafsX4), W401X (c.1202G>A)(c.1202G>A, p.Trp401X), W401X (c.1203G>A) (c.1203G>A, p.Trp401X), 1341+1G>A (c.1209+1G>A), 1461ins4 (c.1329_1330insAGAT, p.Ile444ArgfsX3), A455E (c.1364C>A, p.Ala455Glu), 1525-1G>A (c.1393-1G>A), S466X (C>A) (c.1397C>A, p.Ser466X), S466X (C>G) (c.1397C>G, p.Ser466X), L467P (c.1400T>C, p.Leu467Pro), 1548delG (c.1418delG, p.Gly473GlufsX54), S489X (c.1466C>A, p.Ser489X), S492F (c.1475C>T, p.Ser492Phe), Q493X (c.1477C>T, p.Gln493X), I507del (c.1519_1521delATC, p.Ile507del), F508del (c.1521_1523delCTT, p.Phe508del), 1677delTA (c.1545_1546delTA, p.Tyr515X), V520F (c.1558G>T, p.Val520Phe), Q525X (c.1573C>T, p.Gln525X), 1717-8G>A (c.1585-8G>A), 1717-1G>A (c.1585-1G>A), G542X (c.1624G>T, p.Gly542X), S549R (c.1645A>C) (c.1645A>C, p.Ser549Arg), S549R (c.1647T>G) (c.1647T>G, p.Ser549Arg), S549N (c.1646G>A, p.Ser549Asn), G551D (c.1652G>A, p.Gly551Asp), Q552X (c.1654C>T, p.Gln552X), R553X (c.1657C>T, p.Arg553X), A559T (c.1675G>A, p.Ala559Thr), R560T (c.1679G>C, p.Arg560Thr), R560K (c.1679G>A, p.Arg560Lys), 1811+1.6kbA>G (c.1679+1.6kbA>G), 1812-1G>A (c.1680-1G>A), E585X (c.1753G>T, p.Glu585X), 1898+1G>A (c.1766+1G>A), 1898+3A>G (c.1766+3A>G), 2143delT (c.2012delT, p.Leu671X), R709X (c.2125C>T, p.Arg709X), K710X (c.2128A>T, p.Lys710X), 2183AA>G (c.2051_2052delAAinsG, p.Lys684SerfsX38), 2184insA (c.2052_2053insA, p.Gln685ThrfsX4), 2184delA (c.2052delA, p.Lys684AsnfsX38), 2307insA (c.2175_2176insA, p.Glu726ArgfsX4), L732X (c.2195T>G, p.Leu732X), 2347delG (c.2215delG, p.Val739TyrfsX16), R764X (c.2290C>T, p.Arg764X), 2585delT (c.2453delT, p.Leu818TrpfsX3), E822X (c.2464G>T, p.Glu822X), 2622+1G>A (c.2490+1G>A), E831X (c.2491G>T, p.Glu831X), W846X (c.2537G>A, p.Trp846X), R851X (c.2551C>T, p.Arg851X),  2711delT (c.2583delT, p.Phe861LeufsX3), 2789+5G>A (c.2657+5G>A), Q890X (c.2668C>T, p.Gln890X), L927P (c.2780T>C, p.Leu927Pro), S945L (c.2834C>T, p.Ser945Leu), 3007delG (c.2875delG, p.Ala959HisfsX9), G970R (c.2908G>C, p.Gly970Arg), 3120G>A (c.2988G>A, p.Gln996=), 3120+1G>A (c.2988+1G>A), 3121-1G>A (c.2989-1G>A), 3272-26A>G (c.3140-26A>G), L1065P (c.3194T>C, p.Leu1065Pro), R1066C (c.3196C>T, p.Arg1066Cys), R1066H (c.3197G>A, p.Arg1066His), L1077P (c.3230T>C, p.Leu1077Pro), W1089X (c.3266G>A, p.Trp1089X), Y1092X (C>A) (c.3276C>A, p.Tyr1092X), Y1092X (C>G) (c.3276C>G, p.Tyr1092X), M1101K (c.3302T>A, p.Met1101Lys), E1104X (c.3310G>T, p.Glu1104X), R1158X (c.3472C>T, p.Arg1158X), R1162X (c.3484C>T, p.Arg1162X), 3659delC (c.3528delC, p.Lys1177SerfsX15), S1196X (c.3587C>G, p.Ser1196X), W1204X (c.3611G>A) (c.3611G>A, p.Trp1204X), W1204X (c.3612G>A) (c.3612G>A, p.Trp1204X), 3791delC (c.3659delC, p.Thr1220LysfsX8), 3849+10kbC>T (c.3717+12191C>T), G1244E (c.3731G>A, p.Gly1244Glu), 3876delA (c.3744delA, p.Lys1250ArgfsX9), S1251N (c.3752G>A, p.Ser1251Asn), 3905insT (c.3773_3774insT, p.Leu1258PhefsX7), W1282X (c.3846G>A, p.Trp1282X), 4005+1G>A (c.3873+1G>A), N1303K (c.3909C>G, p.Asn1303Lys), 4016insT (c.3884_3885insT, p.Ser1297PhefsX5), Q1313X (c.3937C>T, p.Gln1313X),  4209TGTT>AA (c.4077_4080delTGTTinsAA, p.Val1360Thrfs), CFTRdele22,23 (c.3964-78_4242+577del), 4382delA (c.4251delA, p.Glu1418ArgfsX14), Reported only if sample has homozygous F508del or I507del: I506V (c.1516A>G, p.Ile506Val), I507V (c.1519A>G, p.Ile507Val), F508C (c.1523T>G, p.Phe508Cys), Reported only if the R117H variation is identified for a sample: PolyTG/PolyT.

Interpretive Data and Information

The gene tested in this assay has been found to be altered in the manifestation of many diseases and conditions. The manifestation of disease is commonly caused by many genes and other variables not addressed in this report, including but not limited to modifier genes, epigenetic factors, environmental factors, and factors that are not known at this time. This report must always be interpreted and considered within the clinical context, and the treating physician(s) should always consider other pertinent information and data that a physician would prudently consider, in addition to the variants identified in this report.

This report has been created based on various scientific manuscripts, references and publicly available databases that describe correlations between certain genetic variants and disease. This information is subject to change over time in response to future scientific and medical findings. The University of Pennsylvania Health System (UPHS) makes no representation or warranty of any kind regarding the accuracy of information provided or contained in these manuscripts, references or other sources of information. If any of the information provided by or contained in the referenced material is later deemed to be inaccurate, this may impact the accuracy of this report and interpretation of the findings. In addition, UPHS is not obligated to update this report based on any future scientific or medical research which may impact the interpretation of this report. In no event will UPHS be liable for any actual damages, indirect damages, and/or special or consequential damages arising out of or in any way connected with the use of this report.

This assay is designed to detect a specific subset of variants in CFTR. The presence of other variants in CFTR is not determined by this assay and failure to identify a variant does not guarantee that other CFTR variants are not present. When applicable, variant zygosity is reported as heterozygous or homozygous, however variant allele fraction (defined as the proportion of variant reads at a given locus) is not reported. This assay does not determine variant causality or whether a variant is inherited. As with any hybridization-based assay, underlying polymorphisms or variants in oligonucleotide-binding regions can affect the alleles being probed and, consequently, the calls made. This assay cannot guarantee all regions will meet variant calling criteria due to technical limitations of the assay and the possibility of underlying genomic changes.

Four variants on this assay (PolyTG/PolyT, p.Ile506Val, p.Ile507Val, p.Phe508Cys) are reported in selected contexts only. If clinically indicated, alternative testing may be pursued to obtain genotype results for these variants outside of the contexts in which they are reported in this assay.

This assay cannot determine whether the orientation of the PolyTG/PolyT variant is in cis/trans with respect to the p.Arg117His variant. Familial genotyping studies may be performed if clinically indicated to assist with determining phasing of the p.Arg117His and PolyTG/PolyT variants.  PolyTG/PolyT variants are homopolymeric regions known to be difficult to interpret with NGS sequence-based assays due to polymerase slippage. Thus the length reported for the PolyTG/PolyT variant may vary from the actual length by ±1 bp.

This test is not indicated for use for newborn screening, fetal diagnostic testing, pre-implantation testing, or for standalone diagnostic purposes.

Clinical Significance

Disease-associated sequence variants in CFTR are identified in individuals with cystic fibrosis (CF) and other CFTR-related disorders such as congenital absence of the vas deferens (CAVD) and pancreatitis. Disease phenotype is dependent on the CFTR variant(s) identified, the zygosity of the variants, as well as other factors. Clinical diagnosis of CF, a recessively inherited disease, requires the presence of two CFTR disease-associated variants (i.e. homozygous or compound heterozygous), while CAVD and pancreatitis can be seen in the setting of a single (i.e heterozygous) CFTR disease-associated variant. If clinically indicated, additional testing for CFTR variants not included in this assay may be appropriate.
Testing Updates

News and Updates

To:       UPHS Physicians and Staff
From: The Division of Precision and Computational Diagnostics (PCD)
            Vivianna Van Deerlin, M.D., Ph.D., Director, Molecular Pathology Laboratory
            Jacquelyn Roth, Ph.D., Molecular Pathology Laboratory
               
Date:  October 29, 2018
Re: METHOD CHANGE for Cystic fibrosis transmembrane conductance regulator (CFTR) variant analysis

In November 2018, the Molecular Pathology Laboratory will perform CFTR variant analysis using an alternative FDA-cleared, next generation sequencing (NGS) methodology (MiSeqDx Cystic Fibrosis 139-Variant Assay), increasing the number of variants detected from the current 23 to a total of 139. This change in methodology is expected to result in increased detection rates of CFTR variants in our patient population. The 23 variants recommended for CFTR screening by the American College of Medical Genetics and Genomics (ACMG) and the American College of Obstetrics and Gynecology (ACOG) are included in the new assay1,2.
 
Testing Highlights of the MiSeqDx Cystic Fibrosis 139-Variant Assay:
  • Includes 134 cystic fibrosis (CF) disease-associated variants, the p.Arg117His (R117H) variant which is classified as a mutation of varying clinical consequence, the intron 8 PolyTG/PolyT modifying variants, and three benign variants (p.Ile506Val, p.Ile507Val, p.Phe508Cys) conditionally reported only in the context of p.Ile507del (deltaI507) or p.Phe508del (deltaF508) homozygosity
  • The disease-associated variants included have allele frequencies of ≥0.01% in individuals affected with cystic fibrosis.
  • The PolyTG/PolyT variant is conditionally reported ONLY in the setting of a p.Arg117His positive result. Phasing of the PolyTG/PolyT and p.Arg117His (i.e., cis/trans determination) is not performed by this assay.
  • Variants will be reported using the standard Human Genome Variation Society (HGVS) nomenclature.  Colloquial variant names can be found at the bottom of the report.
 
Ordering Information:  
  • The name of the orderable in PennChart is being changed to “Cystic Fibrosis – CFTR 139 Variant Analysis” (PxCode C2008401).
     
    Acceptable Specimens for CFTR Variant Analysis:
  • Peripheral blood collected in an EDTA (lavender) tube is the ONLY acceptable specimen Cystic Fibrosis – CFTR 139 Variant Analysis.
     
    For additional information: Call the Molecular Pathology Laboratory (215-662-6121) weekdays during regular business hours.
     
REFERENCES
  1. Watson, et al. Cystic fibrosis population carrier screening: 2004 revision of American College of Medical Genetics mutation panel. Genet Med. 6(5):387-91, 2004.
  2. Committee on Genetics, American College of Obstetricians and Gynecologists. ACOG Committee Opinion. Number 486, April 2011. Update on carrier screening for cystic fibrosis. Obstet Gynecol. 2011 Apr;117(4):1028-31.
Billing Codes

CPT Codes

81220, G0452

LOINC

  • 21654-9

Ordering Information

Cerner Orderable
CFPLUS
Penn Chart Orderable
Cystic Fibrosis - CFTR 139 Variant Analysis; C2008401
Performing Laboratory
Molecular Pathology
Performed
Batched Weekly
Reported
7-10 Days
Methodology
Next Generation Sequencing utilizing Illumina MiSeqDx
Synonyms
  • Cystic fibrosis
  • CFTR
  • Pancreatitis
  • CAVD